Evoluutio, maailmankatsomus & sivuavat aiheet

Viestiketju alueella 'Yleistä keskustelua' , aloittaja Dissident, 01.10.2007.

NOSTOJA MUROPAKETIN SISÄLLÖSTÄ
  1. sumatra

    Rekisteröitynyt:
    17.10.2011
    Viestejä:
    16
    Molexilta tulee hyvää asiaa laittaa ajattelmaan eri kantilta uskon puitteissa. Jumala loi planeetan olosuhteet ja ihmisen planeetalle. Mitä enemmän tiede tutkii sitä monimutkisemmaksi ja epätodennäköisemmäksi menee että kaikki syntyisi tyhjästä. Kaikelle on luojansa ehkä tiede on luotu jotta ihminen voi löytää jumalan.
     
  2. Kanapulla

    Rekisteröitynyt:
    16.08.2006
    Viestejä:
    1 670
    Molexi on alkanut jälleen kierrättää noita kreationistien vanhoja ja vääriä väittämiä, joista hänet itsensäkin on bannattu jo monta kertaa aikaisemmin. Riittikö tämä vihjeeksi vai pitäisikö vielä painaa tuota "ilmoita moderaattorille" -nappia?
     
  3. Hunajamuro85

    Rekisteröitynyt:
    25.08.2010
    Viestejä:
    887
    Minun mielestäni on melko monimutkainen ajatus, että on olemassa kaikkivoipa henkiolento, joka suunnitteli päässään kymmeniä erilaisia atomeja, ja suunnitteli säännöt joilla ne voivat liittyä toisiinsa. Jotta ne voisivat muodostaa monimutkaisempia molekyylejä, ja kehittyä eliöiksi. Jotka voivat sitten tuottaa lisää melko samanlaisia, mutta kuitenkin aina hiukan erilaisia yksilöitä, jolloin erilaisten eliöiden määrä laajeni lopulta miljooniin. Ja kaikki tämä vain, jotta saataisiin tänne yksi eliö palvomaan jumalaa. Kaikki tämä vaiva, ja silti se pässi ei varustanut meitä aistilla, jolla voisimme havaita hänet?

    Todennäköisempää minusta on, että kaikki tapahtui niinkuin tapahtui, koska se ei olisi alussa voinut tapahtua mitenkään muuten. Fysiikan ja kemian säännöt jne. Ja sitten eliöt ottivat asiat omiin käsiinsä ja loivat sen, mitä meillä on tänään.
     
  4. SuperEgo

    Rekisteröitynyt:
    03.07.2001
    Viestejä:
    8 065
    Se, että joku on jääräpäisesti väärässä, on ärsyttävää ja turhauttavaa, muttei vielä varsinaisesti sääntöjen vastaista. Katsotaan nyt, lipsahtaako homma taas saarnaamisen puolelle.

    Sinänsä olisi tietenkin syytä huomioida keskustelussa aikaisemmin esitetyt vasta-argumentit joko kumoamalla ne tai tarkistamalla omaa kantaansa. Inttämällä ja moneen kertaan debunkattuja väitteitä sitkeästi toistelemalla vetää vain mattoa oman asiansa alta ja pelaa suoraan Perkeleen pussiin.
     
    Viimeksi muokattu: 07.01.2012
  5. Mavericc

    Rekisteröitynyt:
    02.07.2000
    Viestejä:
    1 586
    Ja yllättäen linkin takana sekoitetaan Shannonin ja Kolmogorov-Chaitinin informaatioteoroita keskenään ja saadaan jotain, mikä kuulostaa kovin tieteelliseltä, mutta perustuu täysin väärin johtopäätöksiin:
    The Talk.Origins Archive Post of the Month: February 2001

    Ja mutaatioista, tämäkin linkki on murossa esiintynyt useamman kerran:
    CB102: Mutations adding information
     
  6. banaani84

    Rekisteröitynyt:
    20.10.2007
    Viestejä:
    1 204
    Olen vahvasti sitä mieltä että et ymmärrä DNA:n tarkoitusta tai edes sen rakennetta. Ennen kuin puhut asiasta, kannattaisi ottaa asiasta jotain selvää.

    DNA:n emäsosat ovat ns. koodaavia osia. Niitä on olemassa vain ja ainoastaan neljä: adenosiini, tymiini, sytosiini ja guaniini (AT,CG). A-T ovat toistensa vastinemäksiä, kuten C-G. RNA:ssa on tymiinin tilalla urasiili.

    Proteiinisynteesissä (jota en varmaan myöskään ymmärrä) emäskolmikkoon (=kolmen emäksen joukko) liittyy vain ja ainoastaan tietty aminohappo. Aminohapot ovat proteiinien rakennusosia. Aminohappoja on olemassa tasan kaksikymmentä. Listan voit löytää esimerkiksi Wikipediasta.

    Jos halutaan tuottaa jotain proteiinia, aloitetaan DNA:n kopointi RNA-polymeraasi entsyymillä, tätä kopiota kutsutaan esiaste-RNA:ksi. Esiaste-RNA:sta poistetaan ns. koodaamattomat tai turhat osat (silmukointi). Nyt kopiota voidaan kutsua lähetti-RNA:ksi (=mRNA). Solulimassa mRNA tarrautuu ribosomiin, johon aminohappoja kuljettavat lähetti-RNA:t tarttuvat emäspariperiaatteen mukaisesti. Ribosomi rakentaa aminohapoista aminohappoketjun (=proteiini).

    Näin siis proteiinisynteesi yksinkertaisesti selitettynä.

    Kuvittele, että yhdessä emäskolmikossa yksi emäs vaihtuu. Tällöin _mahdollisesti_ koko rakennettu proteiini on erilainen, sillä yksi sen aminohapoista on muuttunut.

    Sanon sanan "mahdollisesti" siksi, että monessa tapauksessa erilaiset emäskolmikot koodaavat saman aminohapon. Esimerkiksi leusiinin koodaavat nämä emäskolmikot UUA, UUG, CUU, CUC, CUA ja CUG.


     
    Viimeksi muokattu: 07.01.2012
  7. shaaka

    Rekisteröitynyt:
    25.07.2011
    Viestejä:
    3 287
    näitähän on hauska lueskella kun keskustelu muuttuu sodaksi :D Kuten Intel vs AMD konsanaan.
     
  8. Urpo Normaali

    Rekisteröitynyt:
    04.07.2009
    Viestejä:
    311
    Ensimmäiset alkueläimet eivät olleet sellaisia monimutkaisia eliöitä kuin nykyään. Aivan alussa kyse oli vain kemikaalista joka kykeni kopioimaan itsensä. Perimä ei ole syntynyt huijauksessa vaan se on rakentunut vähitellen miljardien vuosien aikana.

    Aivan alussa eliöt hädintuskin tarvitsivat perimää koska yksisoluinen eliö ei välttämättä sellaista tarvitse lainkaan jos se kykenee vain kemiallisesti itsensä kopioimaan. Yksisoluisen eläimen solujenhan ei tarvitse erikoistua mitenkään. Ei informaatio elämän alkuvaihessa ollut lainkaan monimutkaista.

    DNA:n tulkinta syntyy siitä kuinka se ohjaa proteiinien valmistusta. Ei kemia tarvitse mitään koodikieltä toimiakseen. DNA on vain tietynlainen kemikaali joka reagoi kemiallisten ominaisuuksiensa mukaisesti muiden kemikaalien kanssa.

    Jos vety yhtyy happeen ja muodostaa vettä, ei tuo reaktio tarvitse mitään kooditulkintaa tai olemassalevaa informaatiota - kaikki tapahtuu luonnonlakien mukaisesti. Samalla tavalla toimii DNA. Kopioitumisen ja luonnonvalinnan seurauksena DNA:ta on vain maailmassa tietynlaisessa tilastollisessa jakaumassa, jonka vuoksi se reagoi kemikaalien kanssa tietyillä tavoilla useammin kuin toisilla tavoilla.

    Kemikaalien olemassaolo ei todellakaan vaadi mitään mystistä informaatiota.
     
  9. 18is9

    Rekisteröitynyt:
    21.01.2011
    Viestejä:
    120
    Ei kö olisi fiksumpaa, että jos ei tiedä niin otetaan asioista selvää? Sitähän se tiede tekee koko ajan. Tiedätkö montako hammasta hevosella on? Kumpi on parempi vaihtoehto, se että uskotaan että niitä on vaikka viisi, vai se, että mennään ja lasketaan?
     
  10. Eternality

    Rekisteröitynyt:
    29.05.2004
    Viestejä:
    1 074
    Ei, vaan jos ei tiedetä, niin silloin ei tiedetä. Uskolla ei ole mitään sijaa todellisuudesta puhuttaessa.


    Ei, DNA ei ole kieli. Kielet ovat ihmisten luomuksia. Yhtähyvin voisit sanoa että universumi on kieli jota fysiikan lait tulkitsevat.

    Niin, tämä on kyllä teoreettisesti mahdollista jos satunnaisia muutoksia tapahtuu tarpeeksi.

    Sinulle tuntuu olevan vaikeaa ymmärtää, niin toistetaan vielä kerran: satunnaisgeneraattori voi tuottaa kaiken sen informaation minkä sinäkin käyttäen samaa aakkostoa.

    Oho, sait jopa aikaiseksi yhden lauseen ilman suurempia virheitä.



    Nyt toki esität laskun missä saat täksi todennäköisyydeksi 0. Odotan mielenkiinnolla...

    Tämä viesti on täysin mahdollista generoida satunnaisesti. Tulkitsija voi tottakai syntyä myös satunnaisesti siinä missä informaatiokin. Mikään ei tätä estä.

    Solun tominta perustuu kemiaan, ja informaatiota voi syntyä. Ja yllättäen evoluutio toimii aivan hyvin.


    Tässä on satunnaisesti generoitu merkkijono: 'e6ZFpoFl06olIkj' ja n mutaation jälkeen siitä tulee: 'Molexi on tyhmä' ja yllättäen se sisältää informaatiota. Eli tässä informaatiota syntyi tyhjästä, eikö ole hämmästyttävää.
     
  11. Lazlo_

    Rekisteröitynyt:
    22.08.2007
    Viestejä:
    2 336
    Väitit: "Kaikki eläimet ovat vieläpä järjestäytyneet erillisiksi lajeiksi ja vain saman lajin edustajat voivat lisääntyä niin, että vielä näiden jälkeläisetkin pystyvät lisäänymään."

    Kehälajit osoittavat, ettei asia todellakaan ole näin yksinkertainen.

    Lintujen evoluutiosta on kirjoitettu paljonkin, mutta tiedän, ettei sinut todellisuus kiinnosta.
    Origin of birds - Wikipedia, the free encyclopedia

    Mitkä kaikki yliluonnolliset oliot mielestäsi tulee ottaa huomioon tutkimuksia tehdessä? Tiedän, että sinä haluat kristinuskon jumalan sinne, mutta tasapuolisuuden vuoksi pitää varmaan ottaa vähän muitakin. Entäs joulupukki, otetaanko se? Haltiat ja keijut?

    Miten raamattu ennustaa fossiilien jakautumisen ja mitä fossiileja tulisi löytyä mistäkin kerroksesta, jotta vedenpaisumus olisi totta?

    Millaisia fossiileja tulisi löytyä mistäkin kerroksesta, jotta raamatun ilmoitus olisi totta?
     
  12. Karhukainen

    Rekisteröitynyt:
    27.08.2003
    Viestejä:
    666
    Osa (zip-paketin tapauksessa suurin osa) mutaatiosta on fataaleja. On kuitenkin täysin mahdollista että mutatoitunut zip-paketti on aivan toimiva.

    Raamattu-vertauksesi ontuu, sillä tuossa tapauksessa jonkun pitäisi aina avata saapunut paketti ja tarkistaa on se toivotun kaltainen ja lähettää se sitten eteenpäin (vrt. luonnonvalinta). Kirjan tapauksessa mutaatioita tulisi yksi kirjain silloin tällöin joten tiedoston tarkistajan tulisi päätellä kirjain kerrallaan ollaanko menossa 'oikeaan suuntaan'. Tietenkään kukaan ei oleta että kokonainen kirja ilmestyisi kerralla.

    Eihän se voi olla mitenkään mahdotonta. Esimerkiksi lottoarvonta todistaa väitteesi vääräksi. Joka viikko maailmankaikkeuden kaaoksesta suodattuu lottorivi, jonka mukaan tiedetään kuka voittaja on (kouriintuntuvaa informaatiota). Jos yksi lottoaja saisi olla heittelemässä palloja takaisin kunnes lottorivi on mielensä mukainen on tähän mystiseen kohinaan liitetty jo luonnonvalintakin. Ei tämä voi olla niin vaikeaa ymmärtää, jos vain haluaa.
     
  13. pete0

    Rekisteröitynyt:
    27.07.2000
    Viestejä:
    22
    Ehkäpä Molexi ei halua ymmärtää, kun pelkää jotakin helevettiä. Harvinaisen aivopesty henkilö tai trollaaja, jolla ei ihan kaikki muumit kanootissa.
     
  14. MSM

    Rekisteröitynyt:
    07.12.2006
    Viestejä:
    1 307
    URPOssa on enemmän informaatiota kuin Melanostatiini-hormonin aminohappoketjussa, joka oli vain kolme aminohappoa pitkä ketju. Eli kolme kirjainta (20 kirjaimisessa aakkostossa) on vähemmän kuin URPOssa olevat neljä kirjainta (29 kirjaimisessa suomalaisessa aakkostossa).

    Nythän oli kyse siitä, mistä informaatiota tulee ja voiko sitä tulla. Sillä ei ole nyt hitonkaan vertaa väliä, kuinka paljon sitä tarvitaan. Nyt on kyse siitä, tuleeko sitä edes vähän. Eli onko informaation synty DNA:han mahdollista (ei itse DNA:n synty, eikä ihmisen DNA:n synty, vaan informaation lisäys DNA:han).

    Vastaa tähän: Onko mahdollista tuottaa mainittu kolmekirjaiminen (Pro-Leu-Gly) yhdistelmä sattumanvaraisilla mutaatioilla DNA:han, joka kyseistä hormonia koodaisi?

    DNA:n kohdalla kirjaimet tietty ovat ne A-T-G-C ja niitä tarvitaan 9 kpl, yhtä toimivia eri vaihtoehtoketjuja on 96 tässä tapauksessa. Miksi mikään noista ketjuista ei voi syntyä satunnaisilla mutaatioilla?

    Eihän tuollaista voi edes alkaa laskemaan. Jos olet eri mieltä, niin näytä se lasku. Katsokin sitten, ettet laita mitään aivotonta "0,25^nukleotidien määrä ihmisen genomissa" laskua.

    Aivan varmasti on, vaikka olisinkin 10. Idioottikin tajuaa, että kun kerta mutaatiot muuttavat satunnaisesti genomia, niin silloin siellä informaation määrä kasvaa aivan pakosti, jos mutaatiota on edes muutamia, saati sitten, että kun puhutaan vaikka septiljoonasta mutaatiosta. Jokainen uusi DNA-jakso kun tarkoittaa uutta informaatiota.

    Minulle on aivan yksi ja hailee, mitä informaation määritelmää käytät. Minun ei myöskään tarvitse edes ymmärtää yhtä ainutta informaation käsitettä, tajutakseni, että jos mikä tahansa ATGC pötkö voi kasvaa käytännössä melkein minkä kokoiseksi tahansa (duplikaatiomutaatiot), ja muuttua aivan millaiseksi tahansa (pistemutaatiot), niin silloin se voi muuttua myös ihmisen DNA:ksi.

    Jos tuon informaation lisäämisen joku mekanismi voisi estää, niin se mekanismi olisi jokin yliluonnollinen entiteetti, joka vahtii jokaista mutaatiota, jotta ne eivät luo mitään uutta DNA-jaksoa, joka on jo olemassa. Koska jos mutaatiot ovat sattumanvaraisia, niin silloin niiden on käytännössä täysin pakko luoda uutta informaatiota. Aivan riippumatta informaation määritelmästä. Ja jos määrittelet informaation niin, että mikään lisäys genomissa ei ole uutta informaatiota, niin silloin kyseinen määritelmä ei koske DNA:ta, eikä siten haittaa yhtään mitenkään ATGC-jonojen muuttumista ihmisen genomiksi.

    Miksi muka ei? Jos minä ohjelmoin ohjelman, joka heittää aakkosia sattumanvaraiseen järjestykseen, niin minkä takia viestisi ei sieltä muka voisi ilmestyä, kun tarpeeksi kauan ohjelmaa suoritetaan? Tiesitkö, että tuon vaaditun ajan pystyy jotenkuten myös laskemaan?

    Ei siihen tarvita mitään lakia. Tarvitaan vain satunnaisia kirjaimia tarpeeksi paljon.

    Esimerkiksi tuo kyseinen viestisi lukee jossain pii:n seassa, kun tarpeeksi pitkälle sen desimaaleja luetaan, ja annetaan sen numeroille aakkosia vastaavat kirjaimet.

    Vaan kun se koodikieli on jo olemassa. Nythän oli kyse siitä, mistä DNA:han informaatio syntyy, eikä siitä, mistä se DNA syntyy tai mistä sitä käsittelevä koneisto syntyy.

    Miksi yrität vaihtaa puheenaihetta kesken kaiken? Nyt oli kyse informaation lisääntymisestä.

    Eihän tuo edes tarkoita yhtään mitään. DNA:ta tulkitsee varsin säädelty koneisto, eikä mikään kohina.

    Miksi sitten RNA-pötkö pystyy kopioimaan itseään?

    ATGC -> duplikaatio -> ATGCATGC -> pistemutaatio -> TTGCATGC.

    Mikä kohta tuossa oli mahdoton? Kenties duplikaatiomutaatio? Kenties pistemutaatio? Eikö muka lopputulos ole A) isompi ja B) erilainen?

    Evoluutio kun ei tarvitse mitään muuta toimiakseen, kuin DNA:n, jonne saa lisää nukleotideja, ja joiden järjestystä voidaan muuttaa. Tässä vaiheessa voit unohtaa kokonaan ne älyttömät informaation määritelmäsi, ja vastaa siihen, että mikä estää DNA:n kasvamisen ja muuntumisen ATGC pötköstä ihmisen genomiksi.

    Mikä ihmeen päättelyketju tuo muka on olevinaan? Yhtä järkevä kuin: Ensimmäinen solu syntyy pakosti itsestään, koska solun toiminta perustuu informaatioon.

    Siinä tapauksessa evoluutio ei vaadi informaation lisääntymistä tuolla informaation määritelmälläsi. Evoluutio vaatii ainoastaan sen, että ATGC jono voi muuttua esim. ihmisen genomiksi. Ja sitähän se voi tehdä.

    Lisääntyykö siis informaatio, kun ATGCGTATC muuttuu ATGCGTATCACTAGCATCAGCATCGACCG -muotoon?

    Siinä tapauksessa evoluutio ei vaadi mitään muuta kuin kohinaa.

    Onko olemassaolevaa informaatiota, kun ATGCCG muuttuu ATGCCGATGCCG duplikaatiolla? Entäs kun tämä pistemutaoituu ATGCCGATGCAA:ksi?

    Siinä on jono merkkejä. Ne eivät todennäköisesti tarkoita mitään, ainakaan suomeksi.

    Sen sijaan "Uskotko mitä tässä lukee" on suomea ja se on mutaatioilla synnytettävissä tuosta lauseestasi. Samoin "Tiedätkö mitä tässä lukee: Helsinki" on muodostettavissa lauseestasi, satunnaisuudella. Ja siinä ei informaatio katoa, eikä pelkästään muutu, vaan myös lisääntyy.

    Jos noin tapahtuu DNA:lle, ja se informaatio on tärkeää eliölle, niin se eliöyksilö kuolee. Tai lisääntyy epätodennäköisemmin, jolloin kyseinen kohina poistuu DNA:sta sukupolvien saatossa.

    Sen sijaan se kohina voi luoda uutta informaatiota, kuten antamassani lauseessa.

    Eli annat esimerkin siitä, kuinka informaatiota katoaa, ja sitten väität, että näin se aina on? Mikä helkkarin vajukki-argumentti tuo tuollainen muka on? Miksi et antanut esimerkkiä siitä, kuinka "kohina" toi lisää informaatiota, kuten minä annoin? Eihän se nimittäin mitenkään mahdotonta ole.
     
  15. Mäkitupalainen

    Rekisteröitynyt:
    31.07.2011
    Viestejä:
    3
    Moleksi, taidat kuvitella että on olemassa lajeja ilman yksilöitä. "...miten jokin eläin pitää tehdä..". Tyypillistä platonista huuhaata. Otappa selvää tuosta kehälaji-teoriasta.
     
  16. NenäHerne

    Rekisteröitynyt:
    20.11.2006
    Viestejä:
    220
    Vittu montako kertaa se sulle pitää vääntää rautalangasta? Jos vaikka 2 apinaa yrittää kirjoittaa Shakesparen Othelloa satunnaisesti kirjoituskoneella hakkaamalla ne pystyvät sen kirjoittamaan vaivatta kun aina oikeaan kohtaan osunut oikea kirjain jätetään siihen mihin se kuuluu. Aikaa menee paljon mutta jossain aikamäärässä ne apinat kirjoittavat Othellon.

    Samalla kaavalla kohinasta saadaan vaikka millainen kuva aikaiseksi kun valitaan pikselin tila halutulla hetkellä.

    Evoluutio toimii samalla tavalla, se mutaatio joka toimii jätetään aktiiviseksi DNA:han, haitalliset mutaatiot kuolevat tai jäävät inaktiiveiksi.

    Jos sinun ajatusmaailmasi on tosiaan noi suolesta, niin kehottaisin poistumaan vittuun täältä jauhamasta paskaa ja valehtelemaan koko ajan.
     
  17. eikö tuolle saada jo bannia?
    ei vastaa yhteenkään hänelle esitettyy kysymykseen vaan jatkaa copy-pastailuaan jostain jeesus-sivukta tänne?
     
  18. foenix

    Rekisteröitynyt:
    29.12.2000
    Viestejä:
    379
    Kukas täällä sitten meitä viihdyttää? ;) Sitäpaitsi MSM:n selkeitä vastauksia on mukava lukea
     
  19. kansaIainen

    Rekisteröitynyt:
    11.05.2003
    Viestejä:
    5 895
    Miljoonat lottorivit eivät tuoneet "informaatiota" viime lauantaina, joten kannattaa lotota ensi viikolla, silloin "informaatiota" on luvassa 10.000.000 euroa, jos arvaaminen osuu oikein vain yhdelle. Lotossa aina silloin tällöin satunnaisesti arvatut numerot osuvat oikein, ja silloin tulee voitto.

    Ihan samalla tavoin evoluutiossa tapahtuu satunnaisesti erilaisia muunnelmia, ja silloin tällöin tulee "voitto". Esimerkiksi jollekin saarelle myrskyn lennättämät peipposet kärsii ravintopulasta, kunnes satunnainen geenimuunnos saa yhden peipposen juomaan hautovien albatrossien verta. Se peippo (peikko, kirjoitin ensin) pystyy elättämään enemmän poikasia lisääntymiskuntoon, ja tämä muunnos leviää nopeasti vallitsevaksi ominaisuudeksi saaren peippoihin.

    Jos nyt tämän saaren peippo lentäisi myrskyn mukana mantereelle, ja siellä olisi ominaisuudesta samalla tavoin hyötyä, olisimme pian kusessa vampyyrilintujen kanssa.
     
  20. Derby

    Rekisteröitynyt:
    20.04.2011
    Viestejä:
    1 252
    Curiosity - Did God Create the Universe - YouTube

    Tämän hetken fiksuin kaveri selostaa logiikkansa miksi jumalaa ei ole eikä voikkaan olla. Pätkä on kohtuullisen pitkä, itse jaksoin katsella yhdellä istumalla helposti miten maailma on rakentunut ja miten luonnonlait paljastuivat, ja miten kirkko on aikojen saatossa koittanut tunkea lusikkansa soppaan epäonnistuen joka kerta. Haistan Hawkinsin dokkarissa lievän sarkasmin ajoittain kirkon pyrkimyksille luoda jumala joka väliin mitä tiede on paljastanut.

    En usko että tapauskovaiset edes uskaltavat katsoa tätä dokkaria, maailman viisainta kaveria vastaan kun on todennäköisesti mahdotonta väitellä edes kollektiivisesti yhdessä muiden uskovaisten kanssa. Mutta saapahan fiksut ihmiset katseltavaa.
     
  21. Mikko Laine

    Rekisteröitynyt:
    28.06.2001
    Viestejä:
    1 487
    Asia, mihin en ole koskaan geneettisen koodin hyväksyneen (ja siitä jotakin ymmärtävän) kreationistin nähnyt kommentoineen, on jo tapahtuneen ja tulevien tapahtumien ero. Lottoesimerkki on tässä hyvä. Mikä on todennäköisyys saada vaikkapa rivi 10, 17, 21, 24, 26, 31, 37? Sama 1/15 380 937, mikä kaikille muillekin riveille. Tämä rivi kuitenkin arvottiin viime viikolla. Todennäköisyys tapahtumalle oli noin häviävän pieni (0,0000065 %, paljon nollia, sellaisesta kreationistit yleensä tykkää), mutta se tapahtui kuitenkin.

    Mennään ajassa 50 miljoonaa vuotta taaksepäin. Mikä on todennäköisyys, että jostakin silloisesta nisäkkäästä kehittyy nykyinen koira? Nollia saisi tähän numeroon laittaa vaikka kuinka paljon. Häviävän pieni. Nykyään koiria kuitenkin on olemassa. Tällainen kehitys tapahtui kaikista todennäköisyyksistä huolimatta. Jos nyt kuvailisin jonkin eläimen 50 miljoonaa vuotta tulevaisuudessa, tuskin veikkaisin yhtään mitään oikein. Samoin en voi lottoriviä arvata vaikka sellainenkin tulee arvottua tällä viikolla taas kerran.

    Todennäköisyys jokaisen eläimen olemassaololle (noin siis evoluution kannalta) on hyvin pieni. Kuitenkin eläimet kehittyvät. Joitain oli pakko olla kehityksen tuloksena. Kirjoitukseni ei ota kantaa elämän syntymiseen, pelkään evoluutioon.
     
  22. SniperFin

    Rekisteröitynyt:
    08.08.2002
    Viestejä:
    4 656
    Itse käytän korttipakka esimerkkiä jossa todennäköisyydet ovat vielä kertaluokkaa isommat.
    Sekoitat pakan ja jaat sitten kortit pöydälle, todennäköisyys sille järjestykselle jonka juuri jaoit on 1/52! ja silti onnistuit jakamaan kortit juuri tuossa järjestyksessä. Jos toistat kokeen, onnistut taas jakamaan kortit joiden todennäköisyys on tuo sama. Ja niin edelleen,vaikka latoisit kortteja pöytään koko loppuikäsi, onnistut joka kerta jakamaan ne järjestyksessä jonka todennäköisyys on 1/52!.

    Tässähän on tietysti jujuna se, että koska ei etukäteen määritelty sitä järjestystä mihin pyritään niin todennäköisyydellä ei ole väliä, aina osuu kohdilleen vaikka todennäköisyydet ovat pikkiriikkiset ja kahden identtisen jaon saaminen on miltei mahdotonta vaikka jakaisi kortteja loppu ikänsä. Samoin on evoluution kanssa, ei ole ollut mitään päämäärää, vaan lajit ovat muodostuneet sen perusteella miten mutaatioita on esiintynyt ja miten luonnonvalinta on niitä suosinut/karsinut.
    Jos homma aloitettaisiin uudelleen alusta, lopputulos olisi varmasti aika lailla erilainen.
    Sama tietenkin pätee myös itse maailmankaikkeuteen, kun uskovaiset laskevat noita todennäköisyyksiä (aurinko on oikealla etäisyydellä, maapallon ominaisuudet ovat oikeat,kuukin on hyvällä etäisyydellä ja sen painovoima on suoutuisa jne.). Toki jos tämä olisi ollut se mihin alunperin pyritään niin olisihan ne prosentit olemattomat ja tästä voitaisiin vetää johtopäätöksia sen suhteen että sen takan on oltava jotain älyllistä,mutta kun emme voi tällaista premissiä esittään niin noilta todennäköisyyksiltä katoaa pohja pois.
    Lisäksi en oikein hiffaa tuota miksi uskovaisten edes tarvitsee laskea noita todennäköisyyksiä, jumalahan kaikkivaltiaana olisi kyennyt luomaan elämän ihan millaisiin olosuhteisiin tahansa --> maailmankaikkeus näyttäisi uskovaisen silmissä aina sellaiselta kuin se olisi luotu juurikin meidät mielessä.
     
  23. kansaIainen

    Rekisteröitynyt:
    11.05.2003
    Viestejä:
    5 895
    Kaikkien planeettojen uskovaisten mielestä on suoranainen ihme, että heidän planeettansa on kuin tehty heille. He eivät tajua, että he ovat sen planeetan tuotteita, planeetta on tehnyt heidät, muokannut luonnonvalinnan kautta heistä sellaisia, että pystyvät planeetallaan elämään.
     
  24. Mavericc

    Rekisteröitynyt:
    02.07.2000
    Viestejä:
    1 586
    Ihmettelin kyllä tuota Hawkingin loppupäätelmää: Jumalaa ei tarvita, koska aika syntyi alkuräjähdyksessä? En ihan tuota olisi Hawkingilta odottanut. Miksi tämän universumin luonut jumala olisi sidoksissa aikaan, joka itsessään syntyi alkuräjähdyksessä ja on yksi universumin ominaisuuksista. Kristinuskon Jumalanhan sanotaan jo muutenkin olevan ajan ja avaruuden ulkopuolella; olleen alkuräjähdyksen alkuperäinen syy, eli alullepanija... Imho ei niin kovin vakuuttavaa.

    Ymmärrän kyllä päätelmän siinä mielessä mikäli ajatellaan, että kysymykseen "Mitä oli ennen alkuräjähdystä?" ei ole vastausta, koska aikaa tai mitään muutakaan "ennen" alkuräjähdystä ei ollut olemassa. Mutta tuo pätee vain omaan universumiimme; en näe miten se sopii yhteen nykyisten multiversumiteorioiden kanssa.

    Ja sitten vielä kestosuosikit "mihin universumi laajenee?", "mitä on sen ulkopuolella?". Jospa ne jumalat löytyvät sieltä, tai sitten ei...
     
  25. sumatra

    Rekisteröitynyt:
    17.10.2011
    Viestejä:
    16
    Jos jumala teki hawkingin ja ajan sekä avaruuden. Jumalan on ollut olemassa ennen aikaa ja avaruutta. Taidan olla viisampi kuin hawking, tai hawkingin logiikka on yksinkertaista, en ole kaveria muutenkaan pitänyt oikein minään.
     

Jaa tämä sivu

Alibi
Anna
Deko
Dome
Erä
Hymy
Kaksplus
Kippari
Kotilääkäri
Kotiliesi
Koululainen
Ruoka.fi
Parnasso
Seura
Suomen Kuvalehti
TM Rakennusmaailma
Tekniikan Maailma
Vauhdin Maailma
Golfpiste
Vene
Nettiauto
Ampparit
Plaza
Muropaketti