Evoluutio, maailmankatsomus & sivuavat aiheet

Viestiketju alueella 'Yleistä keskustelua' , aloittaja Dissident, 01.10.2007.

NOSTOJA MUROPAKETIN SISÄLLÖSTÄ
  1. Kanapulla

    Rekisteröitynyt:
    16.08.2006
    Viestejä:
    1 670
    Jännää, että koko ajan toistat uskovasi mitä uskot vain, koska olet leimannut itsesi "uskovaiseksi" ja koska sinulla on päässäsi tietty kuva siitä, mitä stereotyyppisen uskovaisen pitää ehdottomasti uskoa, joten millään muulla ei ole mitään väliä. Samalla se on pelottavaa.
     
  2. Alyniekka

    Rekisteröitynyt:
    03.06.2003
    Viestejä:
    2 693
    Uskovaisena näen että jokin älykäs loi tietyn lähtökohdan, todellisuuden, jossa on valmiit rakennuspalikat, mekanismit ja koneistot, jotka pystyvät kehittymään ja joita pystyy kehittämään sen sijaan että kaikki olisi tehty jo kerralla valmiiksi ilman mahdollisuutta jatkokehitykselle.

    Mikä pakkomielle ihmisellä on uskoa. Et ainakaan kristitty ole kun tuo sotii täysin kristinuskon sanomaa vastaan. Kumpihan on todennäköisempää: se, että kaikki tuli sattumalta jostain joka on kenties aina ollut olemassa vai se, että tätä maailmankaikkeuttakin monimutkaisempi olento on olemassa joka osaa luoda tälläisen ekosysteemin miljardeineen galaksineen.
     
  3. SuperEgo

    Rekisteröitynyt:
    03.07.2001
    Viestejä:
    8 065
    Miten se, miltä minusta tuntuu, mahtaa liittyä mihinkään? Sekä koiranpentujen että norsujen käytös on selitettävissä luonnonvalinnalla. Kuten myös ihmisen keskushermoston toiminta tunteineen ja huumorintajuineen.

    Se, että kasvoton luonto on tuottanut tällaisia ominaisuuksia, tekee niistä paljon arvokkaampia kuin jos jokin palvontaa vaativa narsisti olisi jaellut niitä armopaloina pöydältään.

    Se on hyvä vaihtoehto selitykseksi siinä vaiheessa kun sitä tarvitaan selitykseksi. Toistaiseksi ei tarvita, koska paljon simppelimpiä selityksiä on olemassa. Siksi se tulee näillä näkymin sulkea pois ainakin kaikista itseään tieteellisiksi väittävistä selitysyrityksistä.

    Tiede nimenomaan ei väitä tietävänsä kaikesta kaikkea eikä lopullista totuutta yhtään mistään. Uskikset väittävät tietävänsä lopullisia totuuksia ja yleensäkin asioita, joista ei ole olemassa minkäänlaisia todisteita.
     
  4. Omena

    Rekisteröitynyt:
    23.09.2001
    Viestejä:
    4 900
    Noiden tekstien perusteella susta välittyy sellainen kuva, että olipa maapallo minkälainen helvetin esikartano tahansa, niin ihmettelisit sen kauneutta ja kaikkea elämää mitä se päällään pitäisi. Kaikesta voi löytää kauneutta jos niin haluaa.Tärkeetähän se on arvostaa mitä on, mutta ei sitä pidä vetää överiksi.

    Se, että näät Jumalaa joka puolella on sun valitsemasi näkökulma ei mitään muuta. Jos et olisi kuullut Jumalasta mitään arvostaisit tätä planeettaa ihan eri näkökulmasta. Mun mielestä noi Jumala hommat aina vähän aliarvostaa sitä koko prosessia miksi meillä on tämä planeetta olemassa. Joko Jumala vaan napsautti sormiaan tai sitten se oli miljardien vuosien kehityksen tulos ja monen sattuman summa.
     
  5. foenix

    Rekisteröitynyt:
    29.12.2000
    Viestejä:
    379
    Ei luonnon, elämän, universumin, ihmiselon jne. arvostaminen ja ihmettely jumalaa siihen väliin vaadi. Minusta nuo asiat ovat itsessään mielenkiintoisia ja mielummin arvostan niitä asioita itsessään enkä niiden sijasta jumalaa. Tällaista ajatusta mielestäni monet julkisuuden ateistitkin pyrkivät edistämään, esimerkkinä nyt vaikka Dawkins.
     
  6. Urpo Normaali

    Rekisteröitynyt:
    04.07.2009
    Viestejä:
    311
    Siksi, että en näe mitenkään miten olisi mahdollista tehdä seuraava päättelyketju.

    "Varis katsoo minua velmusti"

    --> seuraus: On olemassa kaikkitietävä, kaikkivaltias kaiken luoja.

    En vain kykene ymmärtämään miten tuosta havainnosta seuraa tuo päätelmä. Minusta se näyttää täysin järjettömältä aivan kuin.

    "Varis katsoo minua velmusti"

    --> seuraus: Planeetat ovat juustoa ja oravat alieneita Nimbur-planeetalta.
     
  7. NenäHerne

    Rekisteröitynyt:
    20.11.2006
    Viestejä:
    220
  8. ________

    Rekisteröitynyt:
    31.08.2011
    Viestejä:
    6 212
    taivaanlahja, oletko koskaan kokenut uskon heikkoutta? Uskosi tuntuu kovin ulkokultaisen opetellulta roolilta.
     
  9. mAd-

    Rekisteröitynyt:
    15.06.2010
    Viestejä:
    361
    Tai kun petoeläin tappaa huomattavasti pienemmän toisen lajin eläimen raatelemalla sen hengiltä. Tai kun ihminen ampuu toisen ihmisen, jota ei tunne ja joka ei ole tehny mitään. Tai kun ihminen joka ei uskonut jumalaan paloi hengiltä roviolla. Tai kun ihmisiä kidutettiin, koska ihminen antoi mielikuvitukselleen ja ahneudelleen vallan ja alkoi orjuuttamaan muita. Onko tämä älykästä suunnitelua? Ei. Sitä muistaa mitä haluaa, jos haluat miettiä elämän kauheita asioita ja niitä hyviä asioita, mielestäsi maailma on kauhea paikka. Mutta jos suljet silmäsi ja korvasi pahoilta asioilta ja huomioit vain hyvät, leikkivät koiranpennut mielestäsi ilmentävät jumalan lahjaa ihmiselle, maailmaa?

    Jossain pitäisi oikeasti mennä se raja.
    Ei löydy sijaa Batmanille eikä Joulupukille maailman luojina. Lisäksi "me tiedetään kaikesta jo kaikki" ei ole rationaalisen ajattelun mukaista. Uskonnolliset tuppaavat sanomaan, että joku asia on jumalan tahto ja sillä sipuli. Eikös se ole vähän kaiken tietämistä? Ainiin, ei tiedetä jumalasta mitään. Muuta kuin, että hänen voi olla mitä tahansa ja milloin tahansa. Hän on kaikkea ja ei ole mitään.

    Ihmiskunnasta tulee yksimielinen silloin, kun kaikki ovat uskosta luopuneet. Miksi? Koska kaikki uskovaiset uskovat eri tavalla. Toinen uskoo Jumalaan ja toinen vaikkapa Allahiin. Toinen uskoo, että kiroilu on syntiä ja toinen ei. Joku uskoo, että maailma tuhoutuu ja toinen uskoo, että Jeesu pelastaa. Mikä sitten yhdistää näitä kaikkia?

    Näitä asioita ei voida todistaa kunnolla. Mikä on "syntiä" ja mikä ei - ei ole todistettavissa. Ei myöskään voida todistaa, että jos olisi joku jumala, niin mikä jumala se olisi, Allah vai Jeesuksen isä. Eikä maailmanloppua voida todistaa.

    Uskonnot ovat kuin ihmisen mielikuvitusta - kaikilla on omanlaisensa. Uskoi tai ei usko. Vaikka suuria uskontoja on vain muutamia, pitää ottaa huomioon, että monet näistä ovat jakaantuneet useampiin pienempiin ryhmiin. Katoliset, ortodoksit.. ortodoksijuutalaiset, juutalaiset..

    Mikä uskonto on oikeassa? Ei voida sitäkään todistaa. Kun uskot kristinuskon jumalaan, kiellät monta sataa muuta jumalaa. Voi sitä ajatella näinkin: Otatko riskin, ja uskot väärään jumalaan kuin et usko ollenkaan? Kumpi on perustellumpaa, olla uskomatta vedoten asia monimutkaisuuteen vai uskoa täysin väärään juttuun?
     
  10. Molexi

    Rekisteröitynyt:
    21.01.2010
    Viestejä:
    1 101
    Tämä jäi vähän askarruttamaan. Mistä se informaatio oikein tulee? Kai kohina on tuttu käsite? Sitähän juuri kuvasit tapahtuvan DNA:lle, sattumanvaraisia vaihteluja geeneissä. Kohinasta ei saa kuin lisää kohinaa vaikka siitä valitsee miten tahansa "parhaat osat". Mistä se informaatio oikein on tullut ja informaatiotahan DNA:n on todistettu olevan?

    Tässä muutama selventävä linkki jos ajatus on hieman epäselvä:
    Frequently Asked Questions
    - The Problem of Information -

    Tätä on kysytty näköjään aiemminkin ja vastaus on selvä: Where did DNA information come from if there is no God

    Onko tässä nyt vihdoin se todiste, ettei elämä ole voinut itsestään syntyä!? Tai sitten selittäkää onko olemassa mekanismia informaation tekemiseksi, jokin muu kuin ihmisen aivot tai jumala?
     
  11. Hunajamuro85

    Rekisteröitynyt:
    25.08.2010
    Viestejä:
    887
    Olen kuullut juttua siitä, että jumala on ajatus, joka sopii ihmisen aivokemioihin hyvin, ja siksi uskosta ei oikein päästä eroon, vaikka tarvetta moiselle selitykselle ei enää ole. Valitettavasti en muista kuka tiedemies tämän sanoi ja missä.

    Omana hypoteesinä heitän, että jumala sopii joidenkin ihmisten aivokemiaan hyvin, ja toisten huonosti. Siksi joillakin ihmisillä voi ylipäätään olla tuo varmuus, tuo tunne, jumalan olemassaolosta ja jopa läsnäolosta. Kun taas jotkut ihmiset eivät saa suggestoitua itseään mihinkään hurmostilaan vaikka kuinka yrittävät.

    Esimerkiksi itse en ole koskaan kokenut jumalaa. Jos minulle ei olisi hänestä kerrottu lapsesta asti, en todennäköisesti olisi itse häntä keksinyt. Etenkään jos olisin jatkuvasti saanut tieteellisiä selityksiä ihmettelemilleni asioille. Maailmakaikkeuden synty ei ole asia, jolla usein päätäni vaivaisin, joten kohdallani jumala oli varmaan jäänyt keksimättä.

    Edes lapsena, kun yritin joskus ahdingossani rukoilla, en juurikaan tuntenut, että joku olisi minua kuullut. Rukouksiini ei koskaan vastattu, mitä pidän lisätodisteena jumalan olemattomuudesta. Miksi jumala kaikessa viisaudessaan olisi päättänyt, että muille ihmisille teen olemassaoloni tiettäväksi, mutta Hunajamurolle en? Näkikö hän jo lapsena sisälläni piilevän pahuuden? Miksi hän sitten teki minusta sellaisen?

    Ihmisen mielenterveyden kannalta usko on todellakin siunaus. Elämä on varmasti kevyempää, kun uskoo että joku kaikkivaltias ukko pitää sinun puoliasi tuolla jossain. Itse en valitettavasti pysty tähän uskomaan. Auringonpaisteen kauneus kimaltavalla lumihangella ei minua saa vakuuttuneeksi. Ja ilmeisesti en mitään oikeasti uskosta hyötyisikään, koska jumala kiduttaa yhtä lailla, ellei enemmänkin, uskovia kuin ateisteja.

    Miksi rakastava jumala katsoo parhaaksi antaa lapsen kärsiä nälkää ja tauteja kymmenen vuotta, ennenkuin vihdoin antaa tämän kuolla? Onko sen tarkoitus opettaa muille ihmisille jotain? Jotain, mitä sadat aiemmin samassa kylässä kuolleet lapset eivät olisi jo opettaneet?
     
  12. Hunajamuro85

    Rekisteröitynyt:
    25.08.2010
    Viestejä:
    887
    LOL. Eihän tuo vastaa yhtään mihinkään. Siinä sanotaan että "Jumala pisti informaation DNA:han, koska jos ei pistänyt, niin mistä se sitten tuli? Mieluummin en miettisi asiaa." :D

    Koska minä en tiedä, miten muovia tehdään, sen on pakko tulla Jumalan peräsuolesta. Eikö?
     
  13. Eternality

    Rekisteröitynyt:
    29.05.2004
    Viestejä:
    1 074
    Väärin. Kohinasta saa informaatiota kunhan vain sattuu sopiva tuuri. Vertaa kuuluisa anekdootti apinoista, kirjoituskoneista ja shakespearesta. Jos arvot satunnaisia kirjaimia jonoon (=kohina) jossain vaiheessa saat jonkin olemassaolevan sanan (=informaatio). Ei sen tarvitse tulla mistään, vaan satunnaisuus voi generoida informaatiota.

    Näistä linkeistä kyllä irtoaa huomattavasti vähemmän informaatiota kuin satunnaisesta kohinasta.

    Tämä vastaus ei ole sevä, vaan selvästi virheellinen.


    Vähemmän yllättäen ei. Informaation olemassaolo on puhtaasti subjektiivista. Ei DNA koodista sinulle mitään informaatiota irtoa, mutta solun sisäisille mekanismeille siitä irtoaa informaatio miten esimerkiksi syntetisoida jokun proteiiini. Eli informaation olemassaoloon tarvitaan tulkitsija, sekä jotain dataa jolla on tulkinta. Kunhan tulkitsija on olemassa, informaatiota voi syntyä minkä tahansa dataa muuttavat prosessin kautta. Tästä esimerkkinä vaikkapa fysiikan lait ja niiden pohjalta universumissa tapahtuvat prosessit.
     
  14. Karhukainen

    Rekisteröitynyt:
    27.08.2003
    Viestejä:
    666
    Voisitko perustella tätä väitettä hiukan syvällisemmin? Vaikkapa esimerkin kautta?
     
  15. innos

    Rekisteröitynyt:
    05.09.2001
    Viestejä:
    3 189
    Pöyristyttävä ajatus. Kyllähän jokainen tietää, että se on tullut Jumalan varpaankynsien alta.
     
  16. Urpo Normaali

    Rekisteröitynyt:
    04.07.2009
    Viestejä:
    311
    Ei mitään informaatiota ole valmiina olemassa. Informaatio syntyy kontekstista.

    Jos jokin DNA -pätkä aiheuttaa sen, että näet pimeässä hiukan paremmin, tuo informaatio on täysin hyödytöntä jos et koskaan ole pimeässä. Käytännössä se on tällöin satunnaisdataa.

    Jos kuitenkin elät hämärässä ja pimeässä, maagisesti samasta satunnaisesta DNA pätkästä tuleekin erittäin tärkeää informaatiota joka ohjaa kehitystäsi eläimenä.

    Ei informaatio synny mistään eikä sitä tarvitse olla olemassa. Erilaiset informaatiojonot vain toimivat eri tavalla erilaisissa ympäristöissä ja niitä jotka toimivat hyvin ja jotka yleistyvät populaatioon, ihminen kutsuu informaatioksi.

    Informaation ja ei-informaation ainoa ero on se, että toinen yleistyy tilastollisesti usein havaituksi ympäristön vaikutuksesta.
     
  17. MSM

    Rekisteröitynyt:
    07.12.2006
    Viestejä:
    1 113
    Mutaatioista. Ihmisen DNA on pitkä jono nukleotideja (ATGC). Mutaatiot luovat uusia nukleotideja ja järjestelevät vanhoja uuteen järjestykseen. Nukleotidit koodavat proteiineja. Kun syntyy mutaatioita, syntyy uudenlaisia proteiineja. Se on sitten tsägästä kiinni, tekeekö kyseinen proteiini mitään vai ei. Mutta kun lätkit satunnaisia mutaatioita tarpeeksi, niin aina välillä joku proteiini tekee jotain. Ja sitä DNA-jaksoa kutsumme informaatioksi.

    Kerro siis, miten olisi mahdollista, että informaatiota ei syntyisi joka ikinen kerta, kun mutaatio muuttaa jotain vanhaa uudeksi? Väitätkö tosissasi, että jokin mekanismi pystyy estämään juuri ne mutaatiot, joissa syntyisi jotain uutta? Miten se muka tapahtuisi?

    Samasta syystä esimerkiksi sana URPO ei mitenkään voi muodostua sattumalta, vaikka kuinka paljon ja kauan heittelisit aakkosia sattumanvaraiseen järjestykseen, niinkö?

    En todellakaan aio lukea linkkejäsi, koska tähän asiaan ei tarvita suurempaa älyä tai tietoa kuin mitä 10-vuotiaallakin on.

    Vastaa tähän: Mutaatiot voivat tuottaa minkä tahansa muutaman sadan tai tuhannen nukleotidin järjestyksen, kyllä vai ei?

    Jos olet eri mieltä, niin kerro meille, miten mutaatiot eivät kykene muodostamaan esimerkiksi nukleotidijonoa CCGTTAGGA, joka koodaisi hormonia nimeltään melanostatiini?
     
  18. SuperstarSupernova

    Rekisteröitynyt:
    25.03.2003
    Viestejä:
    31
    Edelleen, mikä vittu siinä nyt on, ettet voi esimerkiksi hyväksyä sitä, ettemme voi aukottomasti tällä hetkellä tietää, onko jokin syntynyt tyhjästä. Ja jos jostain asiasta ei ole tietoa, se helvetti vieköön ei ole mikään syy täyttää sitä tyhjiötä jumalalla!

    VASTAA SULLE ESITETTYIHIN KYSYMYKSIIN VITUN SPEDE!
     
  19. Hunajamuro85

    Rekisteröitynyt:
    25.08.2010
    Viestejä:
    887
    Noh, jos nyt ihan rehellisiä ollaan, niin pitää myöntää, että me emme VIELÄ tiedä, miten syntyi proteiineja syntetisoiva koneisto, jota soluksi nimitämme. Tai miten DNA ensimmäisen kerran kopioi itsensä.

    Mutta tiedämme aika paljon siitä, miten solun osaset ovat voineet syntyä "tyhjästä" (varsin yksinkertaisista molekyyleistä).

    - ainakin 23 aminohappoa (proteiinin rakennuspalikkaa) saadaan syntymään spontaanisti varhaisen maan olosuhteissa. Eli kun läsnä on vettä, metaania, ammoniakkia ja vetyä, sekä sopivasti salamointia. (Miller-Urey experiment). Lisäksi syntyy tietysti muitakin molekyylejä. DNA koodaa vain 20 aminohappoa.

    - kuivuessaan tuo aminohappovelli muodostaa pitkiä, rihmamaisia, proteiininkaltaisia molekyylejä, protenoideja.

    - vesiliuksessa protenoidit muodostavat niin kutsutun "esisolun" (protobiontti). Eli pallomaisen rakenteen, jolla on ohut kalvomainen ulkoseinä, ja jonka sisällä kemiallisia reaktioita voi tapahtua ulkomaailmalta suojassa. Esim katalyytin läsnäollessa tapahtuu reaktioita, joita ei muuten voisi tapahtua. Esisolu voi myös jakaantua kahtia ja kalvon läpi siirtyy osmoottisesti vettä. Se on siis monella tapaa oikean solun kaltainen.

    - Varsinainen solukalvo on myös automaattisesti muodostuva rakenne. Fosfolipidit (solukalvon rakennuspalikat) muodostavat vedessä automaattisesti pisaroita ja solukalvoja, kun vesipakoiset päät kääntyvät kohti toisiaan ja vesihakuiset päät kohti vettä. O==O Solun sisäosa on myös täynnä tätä fosfolipidikalvoa (endoplasmakalvosto).

    - RNA:ta on todennäköisesti kiittäminen DNA:n synnystä ja monien muidenkin proteiinien katalysoinnista. RNA on ketjumainen molekyyli, joka koostuu DNA:sta poikkeavista nukleotideista. Nukleotidissa on fosfaattiosa, kuten DNA:lla, mutta sokerina riboosi, ja yksi neljästä erilaisesta emäksestä: sytosiini, adeniini, guaniini ja urasiili. Uskon, että alkeellisia RNA-molekyylejä voi syntyä ilman jumalaa kun kemialliset olosuhteet ovat oikeat.

    Erilaisia RNA-molekyylejä on vieläkin nähtävissä runsaasti. On pieniä ja suuria molekyylejä, yksi- ja kaksirihmaisia. Minulle ne ovat todisteita eri kehitysasteista. Tämä RNA-molekyylien laaja kirjo osoittaa mielestäni, että myös DNA:n on ollut mahdollista kehittyä kemiallisesti (ilman jumalaa tai muutakaan suunnittelijaa) yksinkertaisesta molekyylistä monimutkaisemmaksi.

    RNA on mahdollisesti ollut myös mukana kehittämässä itseään ja DNA:ta monimutkaisemmiksi molekyyleiksi. Se nimittäin laskostuu proteiinin lailla, ja voi laskostuneena katalysoida alati monimutkaisempien molekyylien rakentamista.

    Lisäksi meillä on tänäkin päivänä olemassa yksikkojä, joilla on DNA:ta tai RNA:ta, muttei lainkaan omaa aineenvaihduntaa tai solurakennetta. Puhun tietenkin viruksista. Tämäkin on mielestäni todiste aiemmasta kehitysvaiheesta. Tai ainakin alkeellisemmasta tavasta käsitella geneettistä informaatiota. DNA:lla on siis käyttöä muuallakin kuin aitotumallisissa soluissa.

    Joten vaikkei meillä olekaan vielä aivan kaikkia vastauksia elämän syntyyn, todisteita elämän spontaanin synnyn mahdollisuudesta on mielestäni riittävästi, jotta jumala-hypoteesi voidaan hylätä tarpeettomana.
     
  20. Molexi

    Rekisteröitynyt:
    21.01.2010
    Viestejä:
    1 101
    ET TIEDÄ!!!
    Tässäkö on nyt ne todisteet, ettei uskoa tarvita? Jos et tiedä, niin silloin tarvitaan USKOA. Huutamalla ja rähjäämällähän ne todisteet tulevat, kun oikein pinnistää?:rolleyes:

    DNA on eräänlainen kuvauskieli siitä miten jokin eläin pitää tehdä, eikö?

    Zip-paketti on myös kuvauskieli jonkin tiedoston tekemiseksi tiivistetystä kasasta tietoa. Oletko koskaan ladannut zip-paketin, joka ei avaudukkaan vaan tulee virheilmoitus? Zip-pakettiin on tullut satunnaisia mutaatioita siirtovaiheessa. Osa paketin tiedoista voi olla mahdollista pelastaa, mutta osa on tuhoutunut kelvottomaksi, niitä ei voi saada muuten kuin yrittämällä siirtoa uudelleen. Evoluutio väittää, että nämä siirtovaiheessa tapahtuvat satunnaiset virheet voivat saada aikaan sen, että paketin sisältämään raamattu.pdf:ään on ilmestynyt uusi kirja(raamattu on kokoelma kirjoja), kun pakettia siirrellään tarpeeksi monta kertaa eri palvelimien välillä joiden yhteyksissä on huonohkot virheenkorjausmekanismit. Tämän uuden kirjan kieli pitäisi osata sitten myös tulkita jotenkin, joten jos se on vaikka venäjää niin osaamaton ei osaisi sitä lukea. Pdf:än ainoa lukuohjelmakin oli mukana zip:issä, sekä salasana pdf:ään.

    On täysin mahdotonta, että informaatiota saataisiin satunnaislukugeneraattorilla. Niin saadaan ainoastaan kohinaa, joka on informaation vastakohta. Muistat varmaan analogitelevision aikana, kun lumisadetta välillä näkyi? Tämä on kohinaa, se EI sisällä informaatiota eli vaikka uutta jaksoa lempisarjastasi. Vaikka kuinka haluaisitkin, et voi saada kuvaa ilman signaalia eli informaatiota.

    DNA sisältää suuret määrät informaatiota.

    ”There is enough information capacity in a single human cell to store the Encyclopaedia Britannica, all 30 volumes of it, three or four times over.” -Richard Dawkins

    URPO:ssa on kovin vähän informaatiota, esimerkkisi on täysin riittämätön ja liian yksinkertainen! Tiedätkö millä todennäköisyydellä se tietomäärä joka on solussa voisi mukamas itsestään tulla? Todennäköisyys on 0. Jos olet vasta 10-vuotias, niin oletko varma, että ymmärryksesi ja tietosi ovat riittäviä keskustelemaan asiasta, jos et edes viitsi lukea laittamiani linkkejä?

    “Information is information, neither matter nor energy.” -Norbert Wiener
    Laws of information 1

    Käsityksesi informaatiosta on puutteellista. Tämä viesti on informaatiota, se ei voi syntyä satunnaisuudesta. Ei ole olemassa sellaista fysiikan lakia. CCGTTAGGA on kohinaa jolla ei ole mitään merkitystä, jos ei ole jo olemassa jotakin koodikieltä millä sitä tulkita tai mitään mihin sitä tarvitaan. Miten tulkinta on tullut mahdolliseksi? Aivan niin, satunnaisesti -kohinaa! Mutta miten voidaan tulkita kohinalla kohinaa? Tämä on selvittämätön paradoksi ja mahdottomuus, johon ei ole ratkaisua. Tarvitaan valmista informaatiota, jotta voitaisiin käsitellä informaatiota.

    Informaatiota ei synny itsestään. Ensimmäinen solu ei voi syntyä itsestään, koska solun toiminta perustuu informaatioon. Informaatio ei myöskään lisäänny jos siihen lisätään satunnaista kohinaa, informaatiota katoaa jos sitä korvataan kohinalla. Ainoa mekanismi evoluutiolle on kohinan tuottaminen DNA:han. Evoluutio ei yksinkertaisesti toimi ja uusia lajeja eli informaatiota ei synny. On vain mahdollista käyttää jo olemassa olevaa informaatiota, jos mikään ei synnytä informaatiota.

    Tiedätkö mitä tässä lukee:
    Tieidärtkö mgitäh tämssdfä lrukyeie:
    Reirytk mgcich tsäemfälhkyheie:

    Siinä on kohinaa eli satunnaista lisäämistä ja poistamista. Informaatiota katosi, samoin tapahtuu DNA:lle ja väitetään, että informaatiota lisääntyy??:confused: Eipä todellakaan!
     
  21. kansaIainen

    Rekisteröitynyt:
    11.05.2003
    Viestejä:
    5 895
    Molexi, sanooko termi luonnonvalinta sulle mitään, ja jos sanoo, kertoisitko mitä luulet sen tarkoittavan.
     
  22. Molexi

    Rekisteröitynyt:
    21.01.2010
    Viestejä:
    1 101
    Luonnonvalinta on esim:

    Kovakuoriaisia elää saarella jolla puhaltaa kova tuuli. Ne kovakuoriaiset joille kasvaa siivet tuuli puhaltaa merelle, pois saarelta. Jäljelle jää ne kovakuoriaiset joille ei kasvanut siipiä. Informaatio siipien tekemiseen katosi ja saarella elää ainoastaan siivettömiä kovakuoriaisia.

    Kahdella koiralla on keskipitkä turkki ja ne saavat pitkäkarvaisia ja lyhytkarvaisia jälkeläisiä. Tulee kovin kuuma kesä ja ainoastaan lyhytturkkiset eivät kuole kuumuuteen. Pitkän ja keskipitkän karvan informaatio katosi geeniperimästä ja syntyy enää ainoastaan lyhytkarvaisia.

    On peippoja joilla esiintyy lyhyitä ja pitkiä nokkia, jostain syystä se kasvi josta lyhytnokkaiset pystyivät syömään kuoli sukupuuttoon. Lyhytnokkaiset eivät enää saaneet ravintoa ja kuolivat. Jäljelle jäi pitkänokkaisia peippoja, lyhytnokkaisuuden informaatio hävisi geeniperimästä.

    Luonnon "valintaa" olosuhteiden pakosta, mutta tämä on informaatiota tuhoava prosessi, koska luonnonvalinta ei voi lisätä, "se" ainoastaan poistaa sopimattomia eläimiä ympäristöstä.
     
  23. kansaIainen

    Rekisteröitynyt:
    11.05.2003
    Viestejä:
    5 895
    Millä perusteella "luonnonvalinta ei voi lisätä"?

    Ihmisen esi-isät lähtivät aikaan jostain syystä liikkeelle kotisijoiltaan Afrikasta. He kulkeutuivat mm. kylmille seuduille, jossa oli pakko pukeutua turkiksiin, ja rakentaa majoja, kehitellä uusia aseita, luopua mustasta ihonväristä, jne. Tämä kaikki vaati myös isompia aivoja. Jos luonnonvalinta voi ainoastaan kutistaa aivoja, miten on mahdollista, että valkoisilla kuitenkin on isommat aivot kuin mustilla?
     
  24. Hunajamuro85

    Rekisteröitynyt:
    25.08.2010
    Viestejä:
    887
    Geneettinen koodi ? Wikipedia

    Tuolla on kaava jolla RNA:n koodi ratkaistaan. Sama tekniikka pätee DNA:lle, mutten löytänyt nopeasti taulukkoa. Joten käytetään RNA:ta ja otetaan esimerkki:

    AUGCUAAGGCUAGCUAGCCCAUGCUCUGGC

    AUG kertoo että koodaaminen aloitetaan tästä, eka aminohappo jota käytetään on aina metioniini. Eli kemiaksi tuossa lukee että:

    metioniini- leusiini-arginiini-leusiini-alaniini-seriini-proliini-kysteiini-seriini-glysiini

    Lisätään pistemutaatio:

    AUGCUAAGGCUAGCUAGCGCCAUGCUCUGGC

    Kieli on yhä luettavaa, koska jokaiselle 64 eri vaihtoehdolle, jonka voit noista kirjaimista muodostaa (3-kirjaiminen sana kun käytettävissä 4 kirjainta), on olemassa merkitys. Monet niistä tarkoittavat samaa aminohappoa, koska niitä on käytettävissä vain 20. Joten nyt siinä lukee:

    metioniini- leusiini-arginiini-leusiini-alaniini-seriini-alaniini--metioniini-leusiini-tryptofaani.

    Mitä tahansa teet tuolla koodille, siinä lukee AINA jotakin. Ja seurauksena joko valmistetaan joku proteiini, samanlainen tai erilainen kuin ennen, tai ei valmisteta mitään. Mutaatio saattaa johtaa solun kuolemaan. Mitä väliä, soluja on tuhansia muitakin. Se saattaa johtaa yksilön kuolemaan. Mitä väliä, yksilöitä on tuhansia muitakin. Ja näin olemmekin keksineet evoluution. Ne äärimmäisen harvinaiset mutaatiot, jotka johtavat johonkin aiempaa paremmin toimivaan, jäävät elämään ja leviävät räjähdysmäisesti. Yksinkertainen poikii jotain monimutkaisempaa.
     
  25. Hunajamuro85

    Rekisteröitynyt:
    25.08.2010
    Viestejä:
    887
    Muuten hyvä, mutta se informaatio ei ole varsinaisesti kadonnut. Esimerkiksi lyhyen turkin voisi aiheuttaa DNA:ssa mutaatio geenin koodaamista säätelevässä osassa. Eli yksi geeni, joka aiemmin sanoi et, hei tuotetaan tota proteiinia tosi paljon, kuoli, ja nyt sitä ei enää tuoteta. Mutta se geeni ei kadonnut mihinkään. Ne tuhannet kirjaimet on yhä siellä DNA:ssa ja niitä kopioidaan jälkeläisille. Ja joku kaunis päivä siellä tapahtuu taas mutaatio, joka sanoo et nyt koodataan tota ihan vitusti, kunnes koko koira on pelkkää karvaa.

    Mutaatio muuttaa vain pieniä osia DNA:sta. Se lisää yhden kirjaimen, tai poistaa sen. Se ottaa pätkän ja tuplaa sen. Vaihtaa sen paikkaa. Mut se ei satunnaisesti deletoi pitkiä pätkiä.

    Edit: Eli meillä kaikilla on soluissamme hirveät määrät DNA:ta, jota ei enää käytetä mihinkään. Niinkuin kirjastossa on vanhoja kirjoja, joita kukaan ei enää halua lukea. Mut siellä se silti on, istuu ja odottaa. Ja just nyt sun siittiössä saattaa tapahtua mutaatio, joka aktivoi vanhan geenin. Parin päivän päästä heität mällin eukkosi sisään, ja yhdeksän kuukauden kuluttua syntyy vauva, jolle tulee aikanaan massiiviset kulmahampaat. Tai häntä. Tai valtavasti karvaa. Pelottavaa, eikö?
     

Jaa tämä sivu

Alibi
Anna
Deko
Dome
Erä
Hymy
Kaksplus
Kippari
Kotilääkäri
Kotiliesi
Koululainen
Ruoka.fi
Parnasso
Seura
Suomen Kuvalehti
TM Rakennusmaailma
Tekniikan Maailma
Vauhdin Maailma
Golfpiste
Vene
Nettiauto
Ampparit
Plaza
Muropaketti